Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
rno_circRNA_001555 | |||
Gene | n/a | Organism | Rat |
Genome Locus | n/a | Build | n/a |
Disease | Alzheimer's disease | ICD-10 | Alzheimer's disease (G30) |
DBLink | Link to database | PMID | 29706607 |
Experimental Method | |||
Sample Type | Hippocampal Tissues | Comparison | Aβ1-42-induced AD model rat vs normal rat (n=10 each) |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward ATGAGCAATGACTCCCCAGAA ReverseGAGAGTATGGTCTGTTGCGTTG | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Wang, Z, Xu, P, Chen, B, Zhang, Z, Zhang, C, Zhan, Q, Huang, S, Xia, ZA, Peng, W (2018). Identifying circRNA-associated-ceRNA networks in the hippocampus of Aβ1-42-induced Alzheimer's disease-like rats using microarray analysis. Aging (Albany NY), 10, 4:775-788. |